An effective case of growth hormone treatment on cartilage-hair hypoplasia.
case_report · Level V
Where this comes from
- Record sourced from PubMed, PMID 15780958.
- No licence information is recorded for this record.
- Because redistribution is not established, this page shows the abstract only. Follow the links below for the full text.
Abstract
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.
Medical subject headings
- Cartilage Diseases
- Growth Disorders
- Human Growth Hormone