Rapid detection and quantification of Propionibacteriaceae.
other · Level V
Where this comes from
- Record sourced from PubMed, PMID 18977791.
- Also identified by DOI 10.1136/bjo.2008.146639.
- No licence information is recorded for this record.
- Because redistribution is not established, this page shows the abstract only. Follow the links below for the full text.
Abstract
Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.
Medical subject headings
- Eye Infections, Bacterial
- Gram-Positive Bacterial Infections
- Propionibacterium acnes