Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing.
Where this comes from
- Record sourced from PubMed, PMID 29098346.
- Also identified by DOI 10.1007/s00198-017-4250-6.
- No licence information is recorded for this record.
- Because redistribution is not established, this page shows the abstract only. Follow the links below for the full text.
Abstract
In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).