Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing.

Liu, Y; Ma, D; Lv, F; Xu, X; Wang, J; Xia, W; Jiang, Y; Wang, O et al. · Osteoporos Int · 2018

Where this comes from

Abstract

In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).