Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.
Where this comes from
- Record sourced from PubMed, PMID 30323295.
- Also identified by DOI 10.1038/s41467-018-06909-4 and PMC identifier 6189203.
- No licence information is recorded for this record.
- Because redistribution is not established, this page shows the abstract only. Follow the links below for the full text.
Abstract
In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.